Human Variation & Race

Human Variation & Race

1. High Altitude proposes major environmental stress for humans because of the decreased air pressure and the changes of usually hot climate during the day and freezing climate during the night. High Altitude negatively impacts survival of humans because with a low air pressure, getting enough oxygen supply to one’s low altitude adjusted body proves difficult called Hypoxia. Hypoxia refers to ones own lungs not being able to provide oxygen to our vascular systems, which can lead to many life threatening illnesses that will not resolve until the person if back to normal altitudes.

2. Short-term adaptation:

An example of a short-term adaptation would be an increase in breathing rate and heart rate as we try to supply our body with the proper amount of oxygen.

Facultative adaptation:

Our bodies being to take part in the Acclimatization process. Here our bodies adjust to the new environmental stress by creating more blood cells to aid in carrying oxygen. Our lungs also increase in size to promote osmosis of oxygen and carbon dioxide. Our bodies also enhance our transfer of gases by increasing our vascular network.

Developmental adaptations: 

Indigenous peoples who have lived in high altitudes for thousands of years have experienced developmental adaptations. For example, Indians in the high mountain valleys of Peru and Bolivia have been found to produce more hemoglobin in their blood which helps lung expansion capability. Other peoples have adapted to breathe faster and keep their hemoglobin levels normal. The EPAS1 gene has been found to highly valuable when adapting to high altitude environments. 

Cultural adaptations:

People who wish to climb mountains at such high altitudes carry oxygen tanks to aide the oxygen intake and relieve stress so they do not experience some of the side effects of low air pressure. For people who do not wish to visit these high altitude places for leisure, tool kits, special clothing, ability to make a fire, would all be beneficial.

3. By studying human variation from this perspective across environmental clines we enable ourselves to fully understand the world around us, and the the people living in it. We are able to identify individual stresses and study human variation and adaptation to better understand it. We can use this information in a productive way by preparing ourselves for travel, by understanding what environmental stresses we might face, we are better able to overcome them successfully. 

4. Using race to understand the variation of adaptations in a cline would not be beneficial because it may only address one o adaptation among many. One cannot use race to understand these adaptations because for one, its too broad of a spectrum and does not really serve any purpose when one thinks about altitude. By studying the environmental influences on adaptations is best because we are able to look a the full spectrum, not just a few parts of the adaptations. 

Language, or the lack there of.

Part 1

I found part one to be infinitely easier to execute than part two. I found that although it was difficult to resist the urge to answer a question in language form my body language would suffice for simple yes or no questions. Because of this, My partner completely changed the way she spoke to me and resolved to only ask me yes or no questions that could be easily answered with a nod or a shrug. This proved to be to very time consuming as she would have to ask about ten questions to get the answer one simple question that needed an explanation. 

I believe that if my partner and I represented two different cultures, my partner would definitely be able to communicate her ideas and thoughts by actually speaking. She might get the impression that I lacked intelligence since I would not be able to articulate my thoughts into spoken words. The speaking culture would be able to explain complex ideas while the non speaking culture would be limited to ideas that could be explained physically. 

I believe that in our culture the deaf and the mute experience the most adversity communicating with people that can speak. Although they have learned sign language the truth is, most people who can speak and hear never learn sign language and are forced to communicate with them like my partner had, by asking simple yes or no questions and relying on hand gestures. I imagine this experience to be most frustrating because the person may not suffer from any other disability, and is fully aware of how a person who can speak and hear is interacting with them.

Part 2

I found that speaking with no physical embellishments was almost impossible as I only lasted a few minutes before I got frustrated. My frustration was caused primarily by the fact that I constantly found myself changing my tone or including a physical gesture partly because it is second nature to me.

I felt that my partners were confused by what I was saying, since I monotone they could not understand if I was being serious or funny. I felt that I had no means to display emotion other than the words that I used, and even that did not suffice. 

This experiment revealed that humans are indeed very dependment on the use of signs when speaking. By using non speech language we are able to communicate things that cannot be explained by words alone. For example, someone might not know that I feel uncomfortable talking about a certain subject if I was unable to show an expression on my face.

I definitely do believe  that people who have difficulty reading body language suffer greatly in terms of communication. As a culture we depend on our use of signs and body language to communicate when words fall short of the intended interpretation. I believe that reading body language may always be beneficial to the observer but can reveal more about the person being observed than they intended. For example, someone on an interview may not want the employer to know how nervous he or she is, but if the employer can read body language they will quickly pick up on how the interviewer is feeling. Overall I feel that our cultures use of signs and body language is useful, otherwise I don’t think we would have adapted to be so dependent on it.

Piltdown Hoax

The Piltdown hoax occurred in 1912 in the village of Piltdown, England. Charles Dawson made a discovery that was thought to have changed the perception of human evolution. Among many of his findings in the village of Piltdown, Dawson “discovered” an ape like jaw bone that contained human like teeth and then preceded to discover other fragments of the skull. His findings were said to prove that the big brain evolved before man could walk upright. With the backing of Arthur Smith Woodward no one questioned these findings. It wasn’t until 1949 when scientists used a new method of fluorine testing that proved the skull was about 100,000 years old, in 1953 the first full scale analysis on the fragments revealed that they were indeed forged. The teeth had been filed down, parts had been removed that did not match the skull, and the jaw bone was discovered to be less than 100 years old and be that of a female orangutan. Scientists were shocked that someone would forge artifacts for prestige and resolved to discard the discovery and proceed with “good science”.

As the discovery was proven forged, it became widely understand that human fault and error played more roles than one in this misleading discovery. Greed and national pride overtook Dawson and is thought of as his main motive. However, one must not forget that other scientists played a part in the hoax also. By not fully analyzing the skull before and assuming that it was a true finding scientists enabled themselves to be fooled, and allowed it to change the course of all their studies despite the controversy behind it.

Once the scientific process was put in motion it began to prove the fraudulent findings. The discoveries made in Asia and Africa by scientists who used the correct process began to raise questions about the Piltdown Man. In 1949 a new process that used fluorine content to date fossils revealed that it could not be more than 100,000 years old and paved the way for a second full analysis of the fossils. With more advanced technology, scientists were able to date the jaw bone only 100 years old, and by looking through a microscope they found the teeth had been filed down, along with some of the bones in 1953.

To avoid these occurrences form ever happening again one may think of removing the human factor altogether. Although this may seem like the best solution, one must remember that errors occur through technology as well, humans create the technology used in science, so one must not forget that technology is not always perfect. Personally, I would not remove the human factor from science, because I believe that it something that cannot be replaced. I would actually suggest more human involvement in the process, the more people who examine an artifact the more accurate we can be.

There is a lesson that was learned through the Piltdown Hoax, scientists are flawed and may have ulterior motives. Before the hoax, scientists were thought of as gentleman and scholarly and were not questioned. We know now that anything is possible, making scientists more aware. The Piltdown Hoax personally taught me to always question where I get my “facts” from and if there was a chance they were forged.  I think this is most important now in the internet age as many people search the internet for an answer and walk away with the wrong information not suspecting a thing. 

Dentition in Primates

Lemurs

1. Lemurs are only found in Madagascar, an island that flourishes with tropical forests, dry forests and wet lands.
2. Lemurs have a dentition of  3 premolars and molars, 2 incisors, and 1 canine, with a dental formula of 2133.
3. Prosimians have what is called a toothcomb, which is six of their teeth including incisors and canines that are closely pushed together. The structure of the teeth actually look like a comb .Fruit eating lemurs use their toothcomb for picking out seeds from their fruit and cut through tree bark for sap. Leaf eating lemurs usually have little toothcomb, showing adaptation to the food selection in their own environment.

Spider Monkey

1. Spider monkeys live in tropical rain forests in south Mexico, Bolivia and in Brazil. These tropical rain forests contain the essentials to a spider monkey’s diet which consists of leaves, fruits, insects and flowers.
2. Spider Monkeys have a dentition of 3 premolars and molars, 2 incisors, and 1 canine, much like the lemur, with a dental formula of 2133.
3. These fruit eating primates use their incisors to pick fruit of trees, and then use their canines puncture the fruit and their molars to chew it.

 

Baboon

1. Baboons have proven to adapt to many different environments such as savannahs, woodlands, grasslands and rocky hill countries. They can be found in Ethiopia, Saudi Arabia and Yemen among different places. They sleep on tall cliffs or trees, and prefer being close to water and food, but can survive for long periods of time without water by licking the night dew off their own fur.
2. Baboons have a dentition of 2 pre molars, 3 molars, 2 incisors and 1 canine. Making the dental formula 2123.
3. Baboons mainly eat grass, leaves, and blossoms but sometimes eat fish, hares and other small animals. It is possible that the jaw has adapted to their environment by providing a dentition that allows for an omnivorous.

Gibbons

1. Gibbons live in tropical and subtropical rain forests in southeast Asia including parts of southern China.
2. Gibbons have a dentition of 2 pre molars, 3 molars,  2 incisors and 1 canine, with a dental formula of 2123.
3. Gibbons mostly consume fruit which is widely available in their environment. It is reasonable to believe their teeth have adapted in favor of the consumption of large quantities of fruit, making it easier to digest.

 

Chimpanzee

1. Chimpanzees can be found in rain forests and savannahs in Africa.
2. They have 2 pre molars, 3 molars, 2 incisors and 1 canine, making their dental formula 2123 like the gibbons and baboons. 
3. Since the Chimpanzee’s diet contains a very wide variety of food, ranging from plants to small animals, their dentition has adapted to serve the needs of eating both plants and fruits, and animals.

Through the study of these primates dentition patterns one can conclude that the environment and food supply make a direct impact on a primates dental structure. Lemurs and Spider Monkeys share the same dental formula 2133, which directly relates to their similar environment and fruit eating habits. The Baboon, Gibbon and Chimpanzee share the dental formula 2123, and all three share a close environment and food choice as well. The environment has a profound effect on the physical traits of an animal.

Homology and Analogy

1. Koalas and Kangaroos both have marsupiums (pouches) . Kangaroos are found in Australia and have powerful legs and feet that have adapted for leaping. The Koala is also found in Australia and has  thick coat, large ears, long limbs and sharp claws.
2. Both species use their marsupium as means for postnatal care of their offspring. After giving birth, the offspring travel to the pouch for further development and nutrition. The koala marsupium has two teats, and is upside down, while a kangaroo’s marsupium has four teats and is right side up. It’s interesting to note that the koala’s upside down marsupium enables the joey to feed on the mother’s droppings that contain special nutrition for the young.
3. Although the exact species name for the most recent common ancestor of the koala and kangaroo are unknown, we know they split from mammals about 130 million years ago.

1. Humans (homo sapien) and American Alligators(alligator mississippiensis) both posses an analogous trait that can be seen in the structure of the arm. Humans are mammals, have the ability to stand up right and are the only living species of the genus “homo”. American Alligators are reptiles usually known for their strong jawsand lives in freshwater swamps, marshes, lakes and rivers. An adult alligator weighs about 800 pounds and is about 13 feet long, where as an adult human is usually 150 to 180 pounds and about five to six feet tall.
2. Both Humans and American Alligators share analogous traits in their radius, ulna, humerus, and carpals. An Alligator uses his forelegs mainly for transportation on land, while a Human arm has multiple uses and is not primarily used as a way to transport himself on dry land. A human may use his arm to swim in water, but an alligator uses his tail not his forelegs to swim.
3.  The common ancestor between humans and alligators are Devonian Fish about 417 million years ago. Devonian Fishes did not have forearms but had fins, as forearms would not prove useful underwater. It was not until the fish diverged into two categories, fish and reptile that forearms became present.

Protein Synthesis

GTTATACCAAGATCTTACACAAGTCTCCATGACCTGAATCTTAA

Good Luck!

Charles Lyell

The geologist Charles Lyell (1797-1875) is most famous for his idea of uniformitarianism which was initially applied only to geology. Lyell proposed and successfully demonstrated that the earth’s current physical appearance was due to changes that occurred over time in the past and would continue to change the appearance of the earth in the future uniformly. He also emphasized that because of the slow change that occurred over time the earth would have to be at least millions of years old instead of the then believed thousands of years old. Refer to http://www.pbs.org/wgbh/evolution/library/02/4/l_024_01.html for more information on Lyell.

I believe that Lyell’s discovery contributed to Darwin's understanding that “Individuals do not evolve. Populations do.”  Lyell’s theory of uniformitarianism and an earth aged over a million years, aided in supporting darwin’s belief that evolution happens over a gradual period of time, not immediately as suggested by Cuvier.

Darwin may have developed his theory of natural selection without Lyell’s discovery  but he would have lacked support and evidence. In order for natural selection to take place, there would need to be different environments that have been developed over  vast periods of time, relating to Lyell’s theory of an older earth. I do however believe that Lyell’s theory of uniformitarianism was directly applied to living organisms creating the basis for Darwin’s theory of Evolution.

There are a number of reasons for the postponed publication of Darwin’s “On the Origin of Species” the most notable reason was the opposition of the Church. Due to “The Reform Movement” many people associated any thoughts of Evolution with being an atheist and a radical supporter of the Movement. It was said that if these ideas were accepted “ the Church would crash, the moral fabric of society would be torn apart and civilized man would return to savagery”(Desmond and Moore, 1991 p.34). It was not until another scientist Wallace proposed the same ideas of evolution and natural selection as Darwin that he finally decided to go forth with publication.